Friday, March 1, 2024
HomeUncategorizedThe mitochondrial NAD+ transporter SLC25A51 is a fasting-inducible gene

The mitochondrial NAD+ transporter SLC25A51 is a fasting-inducible gene

emphasize

  • mitochondrial NAD+ Transporter Slc25a51

  • is a A fasting-inducible gene.
  • LiverSlc25a51 is regulated by circadian rhythms and is a target of BMAL1.

ReducedSlc25a51 expression inhibits mitochondrial NAD+ levels and in hepatocytes and liver SIRT3 activity.

  • Reduced Slc25a51 expression inhibited the oxygen consumption rate of hepatocytes.

  • Liver reductionSlc25a51 expression results in fatty liver and hypertriglyceridemia in mice.

  • Abstract

    Introducing

    Nicotinamide Adenine Dinucleotide (NAD) It is a core coenzyme in metabolism and energy production. NAD+-dependent sirtuin 3 (SIRT3) regulates acetylation levels of mitochondrial proteins involved in mitochondrial homeostasis . Fasting upregulates hepatic SIRT3 activity, which requires mitochondrial NAD+

  • . So, what is the mechanism that transports more NAD+ to mitochondria to maintain enhanced SIRT3 activity during fasting ?

    objective

      SLC25A51 is a recently discovered mitochondrial NAD+ means of transport. We tested the hypothesis that increased expression of SLC25A51 is required to enhance mitochondrial NAD during fasting + Uptake to maintain SIRT3 activity. Since fasting cycles and circadian rhythms are closely related, we further tested the hypothesis that SLC25A51 is a circadian rhythm-regulated gene.

      method

    We detected Slc25a51 expression in the liver of fasted mice and examined its circadian rhythm in wild-type mice and mice with liver-specific deletion of the clock gene BMAL1 (LKO) . We used shRNA-mediated knockdown to inhibit Slc25a51

  • in hepatocytes and mice Expression in the liver followed by detection of mitochondrial NAD + levels, SIRT3 activity and SIRT3 target proteins (IDH2 and ACADL) levels of acetylation. We measured mitochondrial oxygen consumption rates in hepatocytes with reduced Slc25a51 expression using the Seahorse assay.
  • result

    We found that fasting induced Liver expression of Slc25a51 , whose expression showed a circadian-like pattern, was disrupted in LKO mice. Decreased expression of Slc25a51 in hepatocytes reduces mitochondrial NAD + levels and SIRT3 activity, reflected in increased acetylation of SIRT3 targets. Slc25a51 knockdown decreased the oxygen consumption rate of intact hepatocytes. Mice with reduced Slc25a51 expression in the liver exhibited hepatic mitochondrial NAD

      decreased + levels, hepatic steatosis and hypertriglyceridemia.

      in conclusion

    Slc25a51 is a fasting-inducible gene that is a hepatic SIRT3 required for functionality.

  • abbreviation:

    ACADL (acyl-CoA dehydrogenase long chain), BMAL1 (brain and muscle ARNT-like 1), CLOCK ( Clock circadian regulator), IDH2 (isocitrate dehydrogenase-mitochondrial), NAD (nicotinamide adenine dinucleotide), NAMPT (nicotinamide phosphoribosyltransferase), shRNA (short hairpin RNA), SIRT3 (sirtuin 3), TG (triglycerides), WAT (white adipose tissue)

  • Key words

    Mitochondria

  • NAD
  • SLC25A51

    SIRT3

  • 1. Introduction

    Nicotinamide Adenine Dinucleotide (NAD ) is a coenzyme essential for metabolism and ATP production. NAD consists of two nucleotides, one containing the adenine nucleobase and the other nicotinamide. Oxidized NAD+ plays a key role in oxidative metabolism and a range of cellular processes because it is involved in a variety of enzymes. Required, either as a cofactor or as a substrate [

    1

  • Imai S.

  • Armstrong CM
  • Kaeberlein M.

    Guarente L. The transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase.

  • ,

    2

    Lin SJ

    Defossez PA

  • Guarente L.

  • Extends NAD and SIR2 lifespan in Saccharomyces cerevisiae by restricting caloric intake.

  • ,

  • 3
  • Revollo JR
    • Green AA

      • Imai S.

      NAD biosynthetic pathway mediated by nicotinamide phosphoribosyltransferase Regulates Sir2 activity in mammalian cells.

    ].

    • NAD+-dependent sirtuin 3 (SIRT3) localization in mitochondria [

    • 4

    • Hirsch MD

      Shimazu T.

    • Goetzman E.
      King E.

      • Schwer B.

      • Lombard DB

      • WaitSIRT3 regulates mitochondria through reversible enzymatic deacetylation Fatty acid oxidation.

      • ,

        5

        Ahn BH

        Kim HS

        Song S.

      • Lee IH

      • Liu J.

      • Vassilopoulos A.

        • Wait

        Mitochondrial deacetylation The role of the enzyme Sirt3 in regulating energy homeostasis.

      • ,

        6

        Onyango P.

      • Celic I.
        McCaffrey JM

      • Bock JD

      • Feinberg Associated Press (*​​ SIRT3, the human SIR2 homolog, is an NAD-dependent deacetylase localized to mitochondria.

    • ,

    • 7
    • Lombard DB
    • Alt FW

    • Cheng HL

    • Bunkenborg J.

    • Streeper RS ​​

    • Mostoslavsky R.

    • Wait
    • The mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation.
    • ,

    • 8

    • Schwer B.

    • Bunkenborg J.

    • Verdin RO

    • Andersen JS

    • Verdin E.

    • Reversible lysine acetylation Controls the activity of the mitochondrial enzyme acetyl-CoA synthase 2.
    • ,

      9

    • Huang JY

      Hirsch MD

      Shimazu T.

      He L.

      Verdin E.

      ]. SIRT3 regulates acetylation levels of mitochondrial proteins involved in mitochondrial metabolism and homeostasis. SIRT3 is especially important in the liver to regulate fatty acid oxidation through deacetylation by mitochondrial enzymes during fasting [

    • 4

    • Hirsch, MD

    • Shimazu T.

    • Goetzman E.

    • King E.

      • Schwer B.

        • Lombard DB
      • Wait SIRT3 regulates mitochondrial fatty acid oxidation through reversible enzymatic deacetylation.

      • ,

      • 10
        Yang H.

      • Yang T.
      • Bauer JA

      • Perez E.

      • Matsui T.

      • Carmona JJ

      • Wait
      • Nutrient-sensitive mitochondrial NAD+ levels determine cell viability.

      • ,

      • 11
      • Peek CB

      • Affinati AH
      • Ramsay km
      • Guo Hui
      • in W.

        Senna Los Angeles

      • Wait
      • The circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice.
      • ].

      • The circadian cycle is closely related to the fasting cycle, and the circadian clock is a molecular oscillator that coordinates the storage and use of nutrients throughout the daily cycle . The circadian clock coordinates mitochondrial oxidative capacity by rhythmically regulating NAD+ levels through NAD

          +

        Salvage way[

        11

      • Peek CB

        Affinati AH

      • Ramsay km
      • Guo Hui

      • in W.

        Senna Los Angeles

        • Wait
      • The circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice.
      • ,

      • 12
      • Levine DC

      • Hong H.

      • Weidmann BJ

      • Ramsay km

      • Affinati AH

      • Ms. Schmidt

        Wait

      • NAD(+) controls circadian reprogramming to combat aging via PER2 nuclear translocation.
      • ]. Thus, circadian control of mitochondrial NAD+ availability as well as SIRT3 activity modulates mitochondrial oxidative function during fasting cycles.

      • CLOCK (clock circadian regulator) and BMAL1 (brain and muscle ARNT-like 1) are core transcription factors that drive gene oscillations in a tissue-specific manner throughout the circadian cycle [

        [13]

      • Nakabata Y.
        • Sahar S.

        • Astarita G.

            Kaluzova M.

          • Sassone-Corsi P.
          • Circadian control of the NAD+ salvage pathway by CLOCK-SIRT1.

        • ]. The rate-limiting enzyme for NAD+ biosynthesis is nicotinamide phosphoribosyltransferase (NAMPT), intracellular NAD+ shows circadian oscillations regulated by the core clock mechanism CLOCK:BMAL1 [

          [14]

        • Ramsay km
          Yoshino J.

        • Braces CS

        • Abrassart D.

        • Kobayashi Y.

        • Marcheva B.

        • Wait Biological clock feedback via NAMPT-mediated NAD+ biosynthesis cycle.

        • ]. NAMPT is generally considered a cytoplasmic localized enzyme that is upregulated during fasting [

          [14]

          Ramsay km

        • Yoshino J.

        • Braces CS

        • Abrassart D.

        • Kobayashi Y.

        • Marcheva B.
          • Wait
        • Biological clock feedback loop through NAMPT-mediated NAD+ biosynthesis.

        • ]. During fasting, SIRT3 is required to maintain mitochondrial NAD+ levels to promote fatty acid oxidation [

          11

        • Peek CB
        • Affinati AH

        • Ramsay km
        • Guo Hui

        • in W.

        • Senna Los Angeles
        • Wait
        • The circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice.
        • ,

        • 12
        • Levine DC

        • Hong H.

        • Weidmann BJ
        • pull Muji km
        • Affinati AH

          Ms. Schmidt

        • Wait
        • NAD(+) controls circadian reprogramming to combat aging via PER2 nuclear translocation.
        • ], but it is not known how these levels are controlled.

        • SLC25A51 was recently identified as a mitochondrial NAD+ transporter in mammalian cells to transport cytosolic NAD+ import mitochondrial matrix[
        • 15

        • Luongo TS
        • Eller JM

        • Lu MJ
        • Neil M.
          Raith F.
        • Perry C.

          • Wait

          SLC25A51 is a mammalian mitochondrial NAD ( +) Transporter.

        • ,

        • 16
        • Kory N.

        • Uit de Bos J.
        • van der Rijt S.

          • Jankovic N.

          • Gula M.

          • Arp N.

        • Wait
        • MCART1/SLC25A51 is required for mitochondrial NAD transport.

        • ,

        • 17
          • Girardi E.
          • Agrimi G.

            • Goldman University

            • Fiume G.
            Lindinger S.

            Sedlyarov V.

          • Wait
          • Epistatic drive identifies SLC25A51 as a regulator of human mitochondrial NAD import.

          • ,

          • 18
          • Davila A.

          • Liu Li

          • Chellappa K.

            Redpath P .

          • Nakamaru-Ogiso E.

          • Paulella LM

          • Wait
          • Nicotinamide adenine dinucleotide is transported into mammalian mitochondria.
          • ,

          • 19
          • Ouyang Y.

            Bot AJ

              Rutter J.

            SereNADe master: SLC25A51 coordinates mitochondrial NAD.

          • ,

          • 20

          • Ziegler M.

            Monne M.

          • Nikiforov A.

          • Agrimi G.
            • Heiland I.
            Palmieri F. Welcome to the family: Identification of an animal mitochondrial NAD(+) transporter as a member of the solute carrier family SLC25.

          • ]. Indeed, in SLC25A51-null cells, mitochondrial matrix NAD+ levels, tricarboxylic acid (TCA) circulating flux, and m mitochondrial respiration. Therefore, we hypothesized that the mitochondrial NAD+

          • transporter SLC25A51 might be up-regulated during fasting to maintain SIRT3 activity to meet the energy needs of cells. Since fasting cycles and circadian rhythms are closely related, we further hypothesized that SLC25A51 might be a circadian rhythm-regulating gene.
          • To test these hypotheses, we examined Slc25a51 expression levels in fasting and circadian treatment in rat liver. We also examined the effect of depletion of Slc25a51
          • on SIRT3 targets in hepatocytes and mouse liver Impact.
          • 2. Materials and methods

            2.1 Mouse

            Mice were housed in a 22–24 °C environment with a 14-hour light, 10-hour dark cycle and provided advertising unless Otherwise libitum

          • water and food (6% calories from fat, 8664; Harlan Teklad, Indianapolis, IN) unless otherwise stated. 8-week-old mice were fasted for 20 hours and fed mice as controls. To examine circadian rhythms, four-month-old male wild-type (WT) and BMAL1 liver-specific KO mice [
              [twenty one]

            • Molusky MM
            • crazy.
            • Buelow K.

              • Yin L.
            • Lin Jingdong
            • Peroxisomal localization and circadian regulation of ubiquitin-specific protease 2.
            • ] were housed on a 12-hour light-dark cycle with free access to food and water for at least 2 weeks, then switched to continuous darkness for 24 hours to allow the endogenous clock to run freely . Male C57B6J mice were on HFD for one month, and control mice were ordered from the Jackson laboratory (strain numbers: 380050 and 380,056, respectively). Mice were anesthetized with isoflurane before cervical dislocation was performed. Liver samples from three to five mice per time period per genotype group were collected every 3 hours in constant darkness for 24 hours. All animal protocols were approved by the Wayne State University Animal Care and Use Committee.

            • 2.2 RNA extraction, quantitative real-time PCR

              Dissected tissues were immediately placed into RNAlater solution (Ambion, Austin, NY) for subsequent RNA extraction TX). Total RNA was isolated from tissues using the DNase-treated RNeasy Tissue Mini Kit (Qiagen, Valencia, CA). One microgram of RNA was reverse transcribed into cDNA using random hexamers (superscript; Ambion). Relative expression levels were calculated with β-actin as an internal reference.

            • Mouse primer sequenceSlc25a51 are: forward, 5′-ATGATGGACTCCGAAGCACAT-3′; reverse, 5′-GGGTAAGTGATCGCCACGTT-3′. The primer sequences for mouse SIRT3 are: forward, 5′-GAGCGGCCTCTACAGCAAC-3′; reverse, 5′-GGAAGTAGTGAGTGACATTGGG-3′. The primer sequences for mouse β-actin are: forward, 5′-GTGACGTTGACATCCGTAAAGA-3′; reverse, 5′-GCCGGACTCATCGTACTCC-3.

              Target sequence for Slc25a51

            • : GCTCGAATACAGTCTCAGATT, hairpin sequence : 5′-CCGG-GCTCGAATACAGTCTCAGATT-CTCGAG-AATCTGAGACTGTATTCGAGC-TTTTTG-3′. Hepa1-6 cells were transfected with the shRNA-inserted pLKO.1-puro sequence to generate a stable cell line. Adeno-associated virus serotype 8 (AAV8) expressing shRNA targeting Slc25a51
            • by VectorBuilder (Chicago , IL).
            • 2.3 Co-immunoprecipitation, Western blot analysis and mitochondrial isolation

              Cells were grown in 10 cm dishes and then treated with media only (untreated), scramble shRNA or

            • Transfected growing cells Slc25a51
            • shRNA. Treated cells were harvested and treated with protease inhibitors in 1 ml of lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM NaF, 0.1 mM NaVa, 1% NP-40, and 0.05% SDS) . Next, cell lysates were collected by centrifugation at 13,000 rpm for 15 minutes.
            • For Western blot analysis, 20 μg of total cells were separated on SDS-polyacrylamide gel electrophoresis (PAGE) Lysates were lysed and transferred to PVDF membranes prior to incubation with rabbit antibodies specific for ACADL (PA5-82450, Fisher) or IDH2 (PA5-82450, Fisher, Hampton, NH). GAPDH levels were used for normalization. For co-immunoprecipitation assays, 400 μg of cell lysate was incubated with each antibody ACADL or IDH2-conjugated agarose beads overnight at 4 °C. The protein-bound beads were washed 3 times with lysis buffer and then boiled in 1× SDS-PAGE loading buffer for western blotting using an anti-acetyl-lysine peroxidase antibody (SAB5200092, Sigma, St. . Louis) to detect acetylation, Mo). Band intensities were quantified using ImageJ and acetylation levels were normalized to total protein levels. Mitochondria were isolated using the Qproteome Mitochondria Isolation Kit (Qiagen, Hilden, Germany). SIRT activity was measured using the Universal SIRT Activity Assay Kit (Abcam, Cambridge, UK). Triglyceride levels were measured using a triglyceride quantification kit (Sigma, St. Louis, MO).

              2.4 In vitro

            • Circadian rhythm of primary mouse hepatocytes Rhythm Sync
            • from C57BL/ Primary hepatocytes isolated from 6J mice were subjected to serum shock (50 % horse serum) for 2 hours for circadian synchronization [

        • [twenty two]

          Balsalobre A.

        • Damiola F.
          Schibler U.

        • Serum shock induces circadian gene expression in mammalian tissue culture cells.

        • ]. After serum shock synchronization, the shock medium was changed to serum-free medium. Cell lysates were collected for western blot analysis every 8 hours between 24 hours (0 hours day/night) and 72 hours (48 hours day/night) after serum shock.

        • 2.5 Mitochondrial stress test

          Stable cell lines were seeded at 10,000 cells/well to 0.1 % Gelatin-coated Seahorse XFe24 cell culture microplates (#100777-004, Agilent Technologies, Santa Clara , CA, USA) and cultured overnight in DMEM (#10-013-CV, Corning; Manassas, VA, USA) supplemented with 10% FBS and 1% penicillin/streptomycin. The next day, the growth medium was changed to 675 μL/well XF DMEM medium, pH 7.4 (#103575-100, Agilent Technologies; Santa Clara, CA, USA) supplemented with 10 mM glucose (#103577-100, Agilent Technologies) ; Santa Clara, CA, USA) and 10 mM sodium pyruvate (#103578-100, Agilent Technologies; Santa Clara, CA, USA), without phenol red or FBS. Cells in CO

          2

          Free incubator for 1 h to degas the medium. Simultaneous measurement of oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) in XFe24 Seahorse Extracellular Flux according to Manufacturer’s protocol for analysis. Mitochondrial stress testing was performed by sequential injections of 1 μM oligomycin, 2 μM trifluoromethoxycarbonyl cyanophenhydrazone (FCCP) and 1 μM rotenone/antimycin A using the Seahorse XF Cell Mito Stress Test Kit (#103015-100, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions program proceed. Calculation of mitochondrial stress test readings was performed according to the manufacturer’s instructions.

            2.6 Statistical Analysis

            Data are presented as mean ± s.e.m. Statistical significance was calculated with unpaired two-tailed students t-test unless otherwise stated. One-way analysis of variance (ANOVA) was used to compare the means of three groups, for example

          • , hepatic expression levels of Slc25a51
          • in fed, fasted and re-fed mice. The correlation between the expression levels of Slc25a51

          and SIRT3 was linearized using OriginPro software regression analysis. Testing circadian rhythm patterns using the Cosinor analysis of cosinor.online [

          [23]

        • Fig. 1

        • Molcan L.
        • Time distribution data analysis of Cosinor.
        • ]. If P , the difference is considered to have Statistical significance

        • Fig. 13. result

          3.1

          Slc25a51 expression was induced in mouse liver by fasting

          We assume the expression of

          Slc25a51 was induced by fasting in the liver because Slc25a51When energy demands are high, transport of NAD+

        • into mitochondria may be required. To test this hypothesis, We detected the expression of Slc25a51
        • in mouse liver. The experimental group consisted of males and female mice, the mice were fasted for 20 h. qPCR analysis was then performed to examine Slc25a51 expression.
        • Fasting increases liver Slc25a51
        • expression in males (Fig. 1A) and female mice (Fig. 1B) was at least 2-fold. We next examined fasting for 20 h and then Livers of male mice fed for an additional 4 hours Slc25a51 expression. Fasting induction Slc25a51 was expressed in liver, and Slc25a51 was expressed in re- It returned to its basal level 4 hours after feeding (Fig. 1C). In other words, hepatic expression of Slc25a51
        • was significantly reduced (>70%) after an additional 4 hours of feeding ), compared with fasted mice. Therefore, Slc25a51
        • is a fasting-regulated gene in mouse liver.
        • picture. 1Slc25a51

        • is induced by fasting mouse liver. Liver mRNA levels of Slc25a51
        • in male (A) and female (B) mice, with or without 20-hour fast. Male mice, N=3 per group. Female mice N=5 per group. (C) Liver mRNA levels of Slc25a51 in male mice after fasting for 20 hours , followed by fasting for 4 – Hours of refeeding. N=4, 5, 3 for the fed and fasted groups, respectively group and refeeding group. #, p ##, p ≪ 0.01. Data are presented as mean ± SEM.
        • View larger image
        • Graphic Viewer

        • Download Hi-Resolution Image

        • Download(PPT)

        • 3.2 Slc25a51 and SIRT3


        • LiverSIRT3Identified Is by fasting [

            [4]

            Hirsch, MD

          • Shimazu T.

            • Goetzman E.

            King E.

          • Schwer B.
          • Lombard DB

            Wait SIRT3 Regulation of mitochondrial fatty acid oxidation by reversible enzymatic deacetylation.

          • ]. Check the relationship between SIRT3 and Slc25a51

          • , we checked the liver SIRT3
          • were used to analyze expression levels in the same samples for Slc25a51 expression. Fasting significantly induced the expression of SIRT3 in the livers of male (Fig. 2A) and female mice (Fig. 2B), consistent with previous reports [
            • [4]

              Hirsch MD

            • Shimazu T.
              • Goetzman E.

              • King E.

              • Schwer B.

              • Lombard DB

                Wait SIRT3 via reversible Enzymatic deacetylation regulates mitochondrial fatty acid oxidation.

              • ]. After an additional 4 hours of feeding, the expression level of liver SIRT3

              • returned to basal levels ( Figure 2C).

    Previous articleWhy does gRPC insist on trailers?
    Next articleI made the TI-84 emulator 10x faster by replacing the switch box
    farahat
    RELATED ARTICLES

    LEAVE A REPLY

    Please enter your comment!
    Please enter your name here

    LAST NEWS

    Featured NEWS